In honor of the day, here’s the trailer to one of the finest horror/sci-fi movies ever:
Posts from ‘October, 2010’
Honey Bee in Flight
Here’s a simple image of a worker bee circling in for a landing at her hive. It’d be nice if I could say I used my mad photography skillz to snap a few shots and walk away with this winning photo. But the reality is that the process took two weeks and several thousand exposures [...]
A minor change in lighting, a major effect
Here are two photographs depicting a bevy of young caterpillars skeletonizing a parsley leaf: In the first, light is provided by two diffused strobes from above. In the second, the diffuser is removed, eliminating the even reflection off the surface of the leaf, and one of the strobes is shifted to bounce off a plain [...]
Bug-O-Lanterns: An Entomological Celebration of Halloween
All Hallow’s Eve is nearly upon us, and you know what that means: Bug nerds carving pumpkins. Over at Biodiversity in Focus, Morgan Jackson is sharing some amazingly intricate, anatomically-correct ent-o-lanterns from years past. I’ve added a few more insect-themed pumpkins below. If you’ve got a photo of a bug pumpkin, link it in the [...]
Answer to the Monday Night Mystery
What was that snippet of DNA? I’ll let 10-point winner Julie Stalhut explain: It’s Anopheles gambiae cytochrome P450. A. gambiae is a mosquito that is a malaria vector, and cytochrome P450 expression plays a role in insecticide resistance. So. It’s a piece of a gene that helps mosquitoes counter insecticides, of obvious importance to efforts [...]
A Major New Fossil Deposit, with a Note on Taxonomic Caution
PNAS yesterday carried breaking news by Rust and colleagues of extensive new fossil Indian amber deposits dating to about 50 million years ago and holding exquisitely preserved fossils. How important is this find? It’s huge. Not only does the discovery add an older record to bridge the excellent Dominican (15 mya) and Baltic (40 mya) [...]
Monday Night Mystery: an important piece of DNA
Tonight we head back down to the level of molecular sequence: GGGATCGACAGGGGCTGCCGAATTTGAGGCCCGAA ATTCCCTACGGCAATCTACGCATTCTAGCCCAAAA The challenge: 1. What species donated this sequence? (4 points) 2. What gene is it? (3 points) 3. Why are scientists interested in this gene, in this species? (3 points) The cumulative points winner for the month of October will win their [...]
Enriching the blogroll
Need some new reading? Here are blogs I’ve started following over the past month: 6legs2many: Alison Bockoven, a student at Texas A&M, blogs her work with fire ants and other entomological musings. For a start, check out the silverfish. Context & Variation: Kate Clancy is an Anthropology professor here at the University of Illinois, and [...]
Sunday Night Movie: The Challenge of Filming Monarchs
This behind-the-scenes BBC video has all my favorite things. Charismatic insects, face time with a knowledgeable scientist, narration by David Attenborough, and spectacular cinematography. And, a crossbow. I think I enjoyed it more than the actual film.
Maggot Art
With Maggot Art in the news again I thought I’d share an old painting. How was it done? I dunked a few maggots in non-toxic paint, dropped them one by one on art paper, and they did the rest as they crawled away. More samples from other artists here.
A personal weblog by Illinois-based biologist and photographer Alex Wild.
