Tonight we head back down to the level of molecular sequence:
GGGATCGACAGGGGCTGCCGAATTTGAGGCCCGAA
ATTCCCTACGGCAATCTACGCATTCTAGCCCAAAA
The challenge:
1. What species donated this sequence? (4 points)
2. What gene is it? (3 points)
3. Why are scientists interested in this gene, in this species? (3 points)
The cumulative points winner for the month of October will win their choice of 1) any 8×10-sized print from my photo galleries, or 2) a guest post here at Myrmecos on a safe-for-work topic of their choosing.
A personal blog by Illinois-based biologist and photographer Alex Wild.
It’s Anopheles gambiae cytochrome P450. A. gambiae is a mosquito that is a malaria vector, and cytochrome P450 expression plays a role in insecticide resistance.
Metabolizes DDT. Uh-oh.
Yep it is Anopheles gambiae cytochrome P450, but I think the issue is that they suspect that this species is splitting up into two species with different behavior and different sensitivity towards insecticides. And P450 is of course important for A agmbiae to detoxify insecticides…
Cheers
Martin
Species: Anopeles Gambiae aka bad bad bad malaria mosquito!
Gene : cytochrome P450 CYP6Z1 (cyp6z1)
interest : confer resistance to DDT
reference:
Comparative molecular modeling of Anopheles gambiae CYP6Z1, a mosquito P450 capable of metabolizing DDT
Chiu TL, Wen Z, Rupasinghe SG, Schuler MA.
Proc Natl Acad Sci U S A. 2008 Jul 1;105(26):8855-60. Epub 2008 Jun 24.
[...] was that snippet of DNA? I’ll let 10-point winner Julie Stalhut explain: It’s Anopheles gambiae cytochrome P450. A. [...]
[...] own, but my straight up ID challenges are starting to seem a little unimaginative compared to the DNA sequence, crypsis, mimicry, taxonomy fail, and other challenges being offered up by bug blogdom’s more [...]