Alex Wild on insects, science, and photography
What was the source of last night’s crazy wailing and whooping? The culprit looks every bit as odd as it sounds! Treehoppers communicate with vibration, and the recording I featured last night was the courtship signal a male Heteronotus broadcasts along a plant stem to woe females. I borrowed the clip from Rex Cocroft’s collection [...]
Many writers have taken to longform blogging, whereby they use the online medium to pen deeper missives than space-constrained print outlets allow. I am not a writer. However, I suppose we photobloggers should keep up with the times. Thus, I bring you longform photoblogging: I’d do more of these long thin photos, but first I [...]
Tonight’s challenge- supplied by the fine entomologists at North Carolina State University*- is the mating call of a male insect: The Magical Mystery Sound Who is the creature behind those whoops and hollers? I will award five points for picking the correct family, and five points for picking the correct genus. The cumulative points winner for the [...]
For many entomologists, summer means warm evenings in the wilderness with a UV light and a cooler full of beer.
Bug bloggers are not exactly a large community. If I were optimistic I’d say that there are 100 of us around the world. Maybe. So it’s not as though I expect to run into another bug blogger in any given random place. Random, say, like an Ecuadorian cloud forest: While Mrs. Myrmecos and I were [...]
Monty Python‘s humor may appear absurd, but the farce is built on deeper observation of human foibles. This take on nature documentaries (I’m looking at you, Animal Planet) is spot-on:
Human houses provide warm, dry conditions that mice, cockroaches, silverfish and other animals exploit for a more comfortable existence. Ant houses do the same. Because ants create sanitary spaces with regulated humidity, a number of other species readily move in if given the chance. Here, for example, is a springtail:
Is it Thursday already? And I’ve not answered the Mystery of the Alphabet Soup? Crud. I am sooooo far behind this week. This mystery was designed to test how well you really know BLAST search. The correct answer could not be gotten through a regular BLAST of NCBI’s nucleotide collection. Rather, you had to try different [...]
The blog is boring today. I’m prepping files for upload to Genbank. So here’s something completely adorable to look at, instead: If a baby sawfly is not cute enough for you, try to resist this little guy.
Let’s take a break from the photographs for a different sort of challenge. Here is a snippet of insect DNA: TTGCTCAACTCGGTCAAAGCAAGGAAAATAAGGATGCTGTGAAAGCCGATATCGAGAAGTGC My questions are: What species did the DNA come from? (2 points) What were scientists hoping to learn by obtaining this sequence? (8 points) The cumulative points winner for the month of May will [...]
A personal weblog by Illinois-based biologist and photographer Alex Wild.
Myrmecos- derived from the ancient greek word for "ant"- hosts Alex's musings about these and other little creatures that share our planet.
Questions? Comments? Email alwild [at] myrmecos.net
|
| Blog: |
| Myrmecos |
|
Topics:
|
| Insects, Photography, Science |
|
|
