Alex Wild on insects, science, and photography
Tonight’s entomological challenge is for the fighting Illini. What is this orange monstrosity? Points will be awarded as follows to the first person to correctly name: the structure (4 points) the family of arthropods to which it belongs (4 points) the chemicals it produces (1 point each) The cumulative points winner for the month of [...]
This ant looks like it’s wearing the insect equivalent of tuxedo shorts. Formal wear and pasty white legs. If you visit Cape Tribulation, keep an eye out for these little insects. Only 2-3 millimeters long, they are one of the most common ants in that area. I found them nesting in nearly every rotting log [...]
If you’re in the twin cities region of Minnesota and would like to hear about braconid wasp taxonomy & evolution, I’ll be giving the following presentation tomorrow afternoon: “Traveling Across the Taxonomic Impediment: Tales from Tropical Wasps.” 490 Hodson Hall 28 February 2012 3:00 Refreshments 3:15 Seminar Dept. of Entomology University of Minnesota The University [...]
This adorable 1983 animation by Eduard Nazarov was one of the films featured at last night’s Insect Fear Film Festival:
Ant guru Jack Longino sends in a myrmecological wonder: Hey Alex, You and/or the antblog might find this interesting. I thought it was pretty cool. Ergatoid queen of Leptogenys josephi, in the process of laying an egg. That’s a big egg! Bet they don’t lay those too fast. Various species of small Leptogenys have these [...]
I can’t help but think taxonomists should be having more fun with the jumping spider genus Helpis. Like, Helpis coming. Or, Helpis movethiscouch. photo details: Canon MP-E 65mm 1-5x macro lens on a Canon EOS 7D ISO 200, f/13, 1/200 sec diffuse twin flash
What was the connection between the bizarre blue landscape and the string of nucleotides? I quote Dani, who provided the most complete (if not the fastest) answer: 1) Manduca sexta 2) PolyDNAvirus of Cotesia congregata 3) The Cotesia braconid wasp parasitizes M. sexta and the virus attacks the caterpillar immune system Points are awarded as [...]
While stalking ants in the southern Australian state of Victoria, I encountered one minuscule species over and over again. Another stone, another nest. It was a nearly translucent little dolichoderine: I didn’t think much of it. The insects resembled- in appearance and odor- the ubiquitous Tapinoma that is so abundant elsewhere in the world. That [...]
Among the edible insects, Oecophylla weaver ants are especially tasty. Here’s celebrity chef Gordon Ramsay: I showed this clip as part of the entomophagy lecture for Insects & People this morning. The students’ facial expressions were nearly as entertaining as the video!
1. GCTTAATAAAATTAATTAAATCAGTTTCAAAAATAAGTAGACACGCGTTGTTGTTATTCG 2. Myrmecos points will be awarded to the first person to provide answers to the following questions: What is that bizarre blue landscape? (3 points) To what organism (Genus & species, please) does the DNA sequence belong? (2 points) What is the connection between these two things? (5 points) The cumulative points winner for [...]
A personal weblog by Illinois-based biologist and photographer Alex Wild.
Myrmecos- derived from the ancient greek word for "ant"- hosts Alex's musings about these and other little creatures that share our planet.
Questions? Comments? Email alwild [at] myrmecos.net
|
| Blog: |
| Myrmecos |
|
Topics:
|
| Insects, Photography, Science |
|
|
