Alex Wild on insects, science, and photography
1. GCTTAATAAAATTAATTAAATCAGTTTCAAAAATAAGTAGACACGCGTTGTTGTTATTCG 2. Myrmecos points will be awarded to the first person to provide answers to the following questions: What is that bizarre blue landscape? (3 points) To what organism (Genus & species, please) does the DNA sequence belong? (2 points) What is the connection between these two things? (5 points) The cumulative points winner for [...]
A personal weblog by Illinois-based biologist and photographer Alex Wild.
Myrmecos- derived from the ancient greek word for "ant"- hosts Alex's musings about these and other little creatures that share our planet.
Questions? Comments? Email alwild [at] myrmecos.net
|
| Blog: |
| Myrmecos |
|
Topics:
|
| Insects, Photography, Science |
|
|
