1. GCTTAATAAAATTAATTAAATCAGTTTCAAAAATAAGTAGACACGCGTTGTTGTTATTCG
2.
Myrmecos points will be awarded to the first person to provide answers to the following questions:
- What is that bizarre blue landscape? (3 points)
- To what organism (Genus & species, please) does the DNA sequence belong? (2 points)
- What is the connection between these two things? (5 points)
The cumulative points winner for the month of February will take home their choice of 1) any 8×10-sized print from my photo galleries, or 2) a guest post here on Myrmecos.
Good luck!
A personal weblog by Illinois-based biologist and photographer Alex Wild.



















Lateral surface of Mandcua sexta caterpillar? Sequence is Cotesia sp. which parasitizes the cat!
Specifically Cotesia congreta, a virus.
C. congregata, sorry.
1) Manduca sexta
2) PolyDNAvirus of Cotesia congregata
3) The Cotesia braconid wasp parasitizes M. sexta and the virus attacks the caterpillar immune system
Feeling like i’m back to the linnean games…
Damn people are fast. Maybe you could moderate comments for the first 24 hours on these mystery posts and not show comments for a bit. Still give all or majority of points to first poster, but maybe give tie-breaker points to others who get it right before the answer is revealed.
Just a minor suggestion that would allow more people to play along. Yes I am bitter that I got beat to the molecular answer
Next week you should set a camera trap here !!
http://www.youtube.com/watch?v=O2Vpqb47S7c
Ha!
If that is a Manduca sexta larva, it is obviously lab-reared, as only artificial diet-fed caterpillars develop that shocking blue color, while plant-fed ones are a more normal shade of green.
1. Lepidopteran larvae (Manduca sexta)’s external surface
2.Cotesia congregata virus (GenBank Accession no. : AJ632318.1)
3. The DNA belongs to a polydnavirus (Bracovirus) which are used by parasitic wasps to infect the wasps’ host (lepidopteran larvae) and manipulate the host’s defense
mechanism and allow the development of the parasitoid larvae.
1. Lepidopteran larva’s external surface
2.Cotesia congregata virus (GenBank Accession no. : AJ632318.1)
3. The DNA belongs to a polydnavirus (Bracovirus) which are used by parasitic wasps to infect the wasps’ host (lepidopteran larvae) and manipulate the host’s defense
mechanism and allow the development of the parasitoid larvae.
sorry.. published twice… oppps…
hey alex, just thought you would find this interesting.
http://www.ebay.com/itm/BABY-BLACK-SCORPION-UD-GOODWIN-ENTOMOLOGY-SPECIMEN-SP-RARE-ARTIFACT-CARD-/300663852771?pt=US_Baseball&hash=item4600f64ee3
it’s a trading card w/ a real baby black scorpion embedded into it, and apparently it’s up to 3 figures in bidding! wowzers
[...] was the connection between the bizarre blue landscape and the string of [...]