MYRMECOS Rotating Header Image

Monday Night Mystery: A Symbiont Scramble

Tonight’s challenge requires both molecular genetic skills and taxonomic acumen. Below are DNA sequences isolated from microbial associates of various insects. One of the pairs is not correct. Which is the odd pair out?

1. TCCATCGATGTGCATAACTATTTGAATAGCTTGATTAG
ATAATTCAGTAGAGGGAGATTGTCCTGTT


2. ACAGATTGTCTGATGAAATAGCGCGTCAAGCCAATCT
AAGATTGACTAAAGAGCTTGAAGTCCCCTTC

 


3. GTGTACATCCTGGGCAAGGACGAGGGCGGCCGTCACACCCC
GTTCTTCAACAACTACCGTCCGCAGTTC

 


4. TGGGAGAGAAACGAAAGCGAAGGCAAATACCCAAAGGG
TTTCTGTCGATCAAGGGCGAGAGTAGGGGG


I will award 10 Myrmecos points to the first person to correctly pick the erroneous association. Answers must be accompanied by supporting details (such as the correct insect or microbial species) for full credit.

The cumulative points winner for the month of November will win their choice of 1) any 8×10-sized print from my insect photography galleries, or 2) a guest post here on Myrmecos.

Good luck!

Share

10 Comments

  1. Guillaume D. says:

    1) Is Blochmannia floridanus BX248583 host is Camponotus floridanus. Looks good.
    2) Is Glycaspis brimblecombei in scales.
    3) Is Pseudonocardia alni in the symbiotic association between fungus-growing ants and protective Pseudonocardia bacteria, sounds good.
    4) Is Trichonympha sp. with termites.

    Odd one out is 2… because those are aphids not scales.

    1. Guillaume D. says:

      I misread. 2) is not in scales but in psyllids. Still, 2 is the wrong association.

  2. Julie Stahlhut says:

    It’s the second. Arsenophonus endosymbiont — usually associated with scale insects, not aphids. The first endosymbiont is a Blochmannia correctly associated with Camponotus, the third a Pseudonocardia correctly associated with leafcutter ants, and the fourth a Trichonympha correctly associated with termites.

  3. Chris Hamm says:

    #2 is incorect, Arsenophonus is an endosymbiont of whitflies (and aphids are depicted).

  4. Guillaume D. says:

    Julie and Chris are correct. The endosymbiont is Arsenophonus, in my haste to answer quickly I put the host’s name: Glycaspis brimblecombei.

  5. Greg R. says:

    From a totally uneducated perspective… I think it is #3 since it looks mean enough to scare the pair into being wrong. Consider it the Chuck Norris of the ant world.

    1. Chuck Norris doesn’t have genetic markers. Nothing can mark Chuck Norris.

  6. Pedro Rodrigues says:

    It seems like aphids can actually harbor Arsenophonus as a symbiont (see here: http://www.clfs.umd.edu/entm/lamp/publications/willehartman2009.pdf). The trick is that the picture here shows pea aphids (Acyrthosiphon pisum), while the paper by Wille and Hartman (2009) suggest that the association between Arsenophonus and aphids are only found in soybean aphids (Aphis glycine).

  7. [...] so many of you guessed, last night’s odd pair out was #2, the pea aphid with a bacterial symbiont more commonly known from [...]

  8. NancyP says:

    Here for the bug photos, and I get…work! BLAST that sequence, push that bale…

Leave a Reply