Alex Wild on insects, science, and photography
Well. This week’s Great Orange Thingy has aged like a fine cheddar until the weekend, so perhaps at long last it’s time to start blogging again and answer it. Larvae of Papilionidae, the swallowtails, have an eversible structure behind the head that releases defensive chemicals (including isobutyric acid) when the animal is threatened. The odor [...]
Tonight’s entomological challenge is for the fighting Illini. What is this orange monstrosity? Points will be awarded as follows to the first person to correctly name: the structure (4 points) the family of arthropods to which it belongs (4 points) the chemicals it produces (1 point each) The cumulative points winner for the month of [...]
What was the connection between the bizarre blue landscape and the string of nucleotides? I quote Dani, who provided the most complete (if not the fastest) answer: 1) Manduca sexta 2) PolyDNAvirus of Cotesia congregata 3) The Cotesia braconid wasp parasitizes M. sexta and the virus attacks the caterpillar immune system Points are awarded as [...]
1. GCTTAATAAAATTAATTAAATCAGTTTCAAAAATAAGTAGACACGCGTTGTTGTTATTCG 2. Myrmecos points will be awarded to the first person to provide answers to the following questions: What is that bizarre blue landscape? (3 points) To what organism (Genus & species, please) does the DNA sequence belong? (2 points) What is the connection between these two things? (5 points) The cumulative points winner for [...]
What were those molecular beach balls? Pollen would have been an obvious answer, as pollen grains are both common and come in a plethora of forms. But these weren’t pollen grains. They were brochosomes, produced in the malpighian tubules of leafhoppers and serving an as-yet-undetermined function. Perhaps, they have something to do with water retention [...]
While exploring a wasp’s finer details under extreme magnification I stumbled across some rather mysterious structures: What are they? To earn points in tonight’s challenge, be the first person to pick: The name of the objects (5 points). The type of insect usually associated with these (2 pts; hint: not a wasp!). The physiological function (3 [...]
Wow. I swap the standard bug identification for a history trivia challenge and participation jumps not only on this blog but across Facebook, G+, and Twitter! The answer was stated most concisely, if belatedly, by Jesse: Dactylopius coccus, or cochineal scale insects, can be found on the Opuntia cactus in the foreground. The red dye [...]
In a change of pace from our usual identification-based challenges, tonight’s mystery will involve a bit of historical trivia. How so? Consider a landscape from the Rincon mountains east of Tucson, Arizona: I will award 10 Myrmecos points to the first person who can tell me how the subject of this image relates to 18th [...]
Is it Friday already? Crum. It’s been a busy week and I’ve neglected to answer the Case of the Amber Ring. Points go to Julie Stalhut (5 pts) for being first to subfamily and to MarekB for being first to genus (5pts), with 1 pt each awarded to SteveS & Vincent Perrichot for suggesting the [...]
Here’s why I love the internet. Within 24 hours of tweeting a new photo of an odd Australian wasp, I received this tweet back from the fine folks at the NCSU insect museum: I emailed chrysidid expert Lynn Kimsey, a friend from my grad school days back at U.C. Davis. I hadn’t recognized the wasp [...]
A personal weblog by Illinois-based biologist and photographer Alex Wild.
Myrmecos- derived from the ancient greek word for "ant"- hosts Alex's musings about these and other little creatures that share our planet.
Questions? Comments? Email alwild [at] myrmecos.net
|
| Blog: |
| Myrmecos |
|
Topics:
|
| Insects, Photography, Science |
|
|
